International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

Primers used for this study

Gene name Forward primer (5’ to 3’) Reverse primer (5’ to 3’)
SOX9 AGCGAACGCACATCAAGAC CTGTAGGCGATCTGTTGGGG
ACAN TCGAGGACAGCGAGGCC TCGAGGGTGTAGCGTGTAGAGA
COL2A1 GGCAATAGCAGGTTCACGTACA CGATAACAGTCTTGCCCCACTT
CD24 GCACTGCTCCTACCCACGCAGATTT GCCTTGGTGGTGGCATTAGTTGGAT
Tie2 AATCACTATGAGGCTTGGCAACAT GCGTCTCACAGGTCCAGGAT
NANOG GATTTGTGGGCCTGAAGAAA CAGATCCATGGAGGAAGGAA
OCT4 GAGAAGGAGAAGCTGGAGCA AATAGAACCCCCAGGGTGAG
GAPDH CAGCGACACCCACTCCTC TGAGGTCCACCACCCTGT
International Journal of Stem Cells 2020;13:257-67 https://doi.org/10.15283/ijsc20027
© 2020 International Journal of Stem Cells