International Journal of Stem Cells : eISSN 2005-5447

Table. 2.

Table. 2.

Human genes primer sequences for qRT-PCR

Genes Primers (5’-3’)
BGLAP-F GGCGCTACCTGTATCAATGG
BGLAP-R TCAGCCAACTCGTCACAGTC
PPAR-γ-F GCTGGCCTCCTTGATGAATA
PPAR-γ-R TGTCTTCAATGGGCTTCACA
ACAN-F CCCCTGCTATTTCATCGACCC
ACAN-R GACACACGGCTCCACTTGAT
POU5F1-F CTTGAATCCCGAATGGAAAGGG
POU5F1-R GTGTATATCCCAGGGTGATCCTC
NANOG-F TTTGTGGGCCTGAAGAAAACT
NANOG-R AGGGCTGTCCTGAATAAGCAG
IDO1-F TGGGGCAAAGGTCATGGAG
IDO1-R TTTCTTGGAGAGTTGGCAGTAAG
SDF-1-F CCGCGCTCTGCCTCAGCGACGGGAAG
SDF-1-R CTTGTTTAAAGCTTTCTCCAGGTACT
CXCR4-F AGCTGTTGGTGAAAAGGTGGTCTATG
CXCR4-R GCGCTTCTGGTGGCCCTTGGAGTGTG
IGF-1-F AGCCTCCTGTGAAAGTGACG
IGF-1-R GTGCTTCCTTGTAGTAAACGG
TGF-β-F AAATGGATACACCGAACCCAA
TGF-β-R GCTGCATTTGCAAGACTTTAC
HGF-F GCTATCGGGGTAAAGACCTACA
HGF-R CGTAGCGTACCTCTGGATTGC
TSG-6-F TGTCTGTGCTGCTGGATGGAT
TSG-6-R TGTGGGTTGTAGCAATAGGCAT
IL-1Rα-F GAAGATGTGCCTGTCCTGTGTC
IL-1Rα-R CGCTTGTCCTGCTTTCTGTTC
GAPDH-F CATGTTCGTCATGGGTGTGAACCA
GAPDH-R ATGGCATGGACTGTGGTCATGAGT
International Journal of Stem Cells 2020;13:268-78 https://doi.org/10.15283/ijsc20028
© 2020 International Journal of Stem Cells