International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

List of primers

Gene Forward primer Reverse primer
GAPDH (272 bp) TGACCACAGTCCATGCCATCAC CGCCTGCTTCACCACCTTCTT
COX-2 (146 bp) TGACCACAGGCAGATGAA CCACAGCATCGATGTCACCATAG
IDO1 (159 bp) GAATGGCACACGCTATGGAA CAGACTCTATGAGATCAGGCAGATG
IL-6 (234 bp) CCTTCGGTCCAGTTGCCTTCTC CCAGTGCCTCTTTGCTGCTTTC
HGF (147 bp) GTCAGCCCTGGAGTTCCATGATA AGCGTACCTCTGGATTGCTTGTG
TGFβ (130 bp) AGCGACTCGCCAGAGTGGTTA GCAGTGTGTTATCCCTGCTGTCA
IL1β (146 bp) GCTGAGGAAGATGCTGGTTC GTGATCGTACAGGTGCATCG
IL-8 (122 bp) GACATACTCCAAACCTTTCCACCC CCAGACAGAGCTCTCTTCCATCAG
VEGF (150 bp) GAGGGCAGAATCATCACGAAGTGG ATCGCATCAGGGGCACACAGGAT
c-Jun (242 bp) TGGAAACGACCTTCTATGACGA GTTGCTGGACTGGATTATCAGG
NF-κB (103 bp) TGAGTCCTGCTCCTTCCA GCTTCGGTGTAGCCCATT
MMP2 (169 bP) CCGTCGCCCATCATCAAGTT CTGTCTGGGGCAGTCCAAAG
MMP13 (165 bp) GCTGCCTTCCTCTTCTTGA TGCTGCATTCTCCTTCAGGA
RANKL (196 bp) ACCAGCATCAAAATCCCAAG CCCCAAAGTATGTTGCATCC
P53 (463 bp) GCTTGCAATAGGTGTGCGTC AAACTACCAACCCACCGACC
IHH (247 bp) GAACTCGCTGGCTATCTCGG CTCGGACTTGACGGAGCAAT
PTCH1 (298 bp) TGTCGCACAGAACTCCACTC ACCAAGAGCGAGAAATGGCA
PTCH2 (431 bp) TTACCGCAACTGGCTACAGG CGATGGCCTCCACAAAGTCT
SP-1 (130 bp) GGTGCCTTTTCACAGGCTC CATTGGGTGACTCAATTCTGCT
C-fos (280 bp) GGATAGCCTCTCTTACTACCAC TCCTGTCATGGTCTTCACAACG
MMP1 (199) ACTCTGGAGTAATGTCACACC GTTGGTCCACCTTTCATCTTCA
TNFα (215 bp) CGAGTGACAAGCCTGTAGC GGTGTGGGTGAGGAGCACAT
MMP9 (139 bp) GGGACGCAGACATCGTCATC TCGTCATCGTCGAAATGGGC
International Journal of Stem Cells 2021;14:58-73 https://doi.org/10.15283/ijsc19121
© 2020 International Journal of Stem Cells