International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

Primer sequence in this study

Genes Forward primer sequence Reverse primer sequence
αSMA ACTGAGCGTGGCTATTCCTCCGTT GCAGTGGCCATCTCATTTTCA
Collagen I GAGCGGTAACAAGGGTGAGC CTTCCCCATTAGGGCCTCTC
SMAD2 CCGACACACCGAGATCCTAAC GAGGTGGCGTTTCTGGAATATAA
SMAD3 CCATCTCCTACTACGAGCTGAA CACTGCTGCATTCCTGTTGAC
GAPDH TGTGGGCATCAATGGATTTGG ACACCATGTATTCCGGGTCAAT
International Journal of Stem Cells 2020;13:414-23 https://doi.org/10.15283/ijsc20049
© 2020 International Journal of Stem Cells