International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

The information of primers

Targets Primer sequence (5’-3’) Annealing temperature (℃) Function Referenced website of function
JUNB Sense: ACGACTCATACACAGCTACGG 58 Basic cellular activities https://www.ncbi.nlm.nih.gov/gene/3726
Antisense: GCTCGGTTTCAGGAGTTTGTAGT
FOS Sense: GGGGCAAGGTGGAACAGTTAT 58 Cell proliferation https://www.ncbi.nlm.nih.gov/gene/2353
Antisense: CCGCTTGGAGTGTATCAGTCA
CXCR7 Sense: TCTGCATCTCTTCGACTACTCA 60 Angiogenic https://www.ncbi.nlm.nih.gov/gene/3726
Antisense: GTAGAGCAGGACGCTTTTGTT
CXCL12 Sense: ATTCTCAACACTCCAAACTGTGC 56 Angiogenic https://www.ncbi.nlm.nih.gov/gene/6387
Antisense: ACTTTAGCTTCGGGTCAATGC
RGS5 Sense: GACATGGCCCAGAAAAGAATCC 58 Angiogenic https://www.ncbi.nlm.nih.gov/gene/8490
Antisense: CACAAAGCGAGGCAGAGAATC
HEYL Sense: GGCTGCTTACGTGGCTGTT 58 Differentiation https://www.ncbi.nlm.nih.gov/gene/26508
Antisense: GACCCAGGAGTGGTAGAGCAT
Notch3 Sense: TGGCGACCTCACTTACGACT 58 Differentiation https://www.ncbi.nlm.nih.gov/gene/4854
Antisense: CACTGGCAGTTATAGGTGTTGAC
Glut1 Sense: CTGGCATCAACGCTGTCTTC 60 Glucose transporter https://www.ncbi.nlm.nih.gov/gene/38109
Antisense: GCCTATGAGGTGCAGGGTC
Hk2 Sense: GAGCCACCACTCACCCTACT 60 Glycolysis https://www.ncbi.nlm.nih.gov/gene/3099
Antisense: CCAGGCATTCGGCAATGTG
International Journal of Stem Cells 2021;14:85-93 https://doi.org/10.15283/ijsc20073
© 2021 International Journal of Stem Cells