International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

The primer sequences used in this study

Gene Sequence (5’-3’)
CD24 Forward ACCCACGCAGATTTATTCCAG
Reverse CACGAAGAGACTGGCTGTTGAC
CD133 Forward GCACTCTATACCAAAGCGTCAAG
Reverse GCACGATGCCACTTTCTCAC
EpCAM Forward GTGTGTGAACACTGCTGGGGT
Reverse CTGAAGTGCAGTCCGCAAACT
miR-140 Forward GGGTAGAACCACGGCTCAAC
Reverse CTCAACTGGTGTCGTGGAGTC
GAPDH Forward CATCATCCCTGCCTCTACTGG
Reverse GTGGGTGTCGCTGTTGAAGTC
U6 Forward CTCGCTTCGGCAGCACAT
Reverse AACGCTTCACGAATTTGCGT

CD24: cluster of differentiation 24, CD133: cluster of differentiation 133, EpCAM: epithelial cell adhesion molecule.

International Journal of Stem Cells 2021;14:275-85 https://doi.org/10.15283/ijsc20157
© 2021 International Journal of Stem Cells