International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

The primers list of PCR

Gene Primer Annealing temperature (℃) Fragment size (bp)
Oct4 CTCTTGTCTACCTCCCTTGCC 57 100
TCTGTTCCCGTCACTGCTCT
Sox2 GGTGCCCTGCTGCGAGTA 57 360
CGGCGGAAAACCAAGACG
Klf4 CGTTGAACTCCTCGGTCTCC 57 170
CGACTAACCGTTGGCGTGA
c-Myc GGACTGTATGTGGAGCGGTTTC 57 487
TGGGCTGTGCGGAGGTTT
nSox2 AGAGAACCCCAAGATGCACA 57 104
GCTTGGCCTCGTCGATAAAC
nKlf4 TCCCGGGGATTCATAGTTCG 57 310
GGGCAAACTTCCATCCACAG
TEAT AGAAGCTAGTCTCCCTGGGA 57 174
CCATCAACCAGCACAGGAAC
CRABP2 AGCAAACTGTGGATGGGAGA 55 168
CGATGTCATCTGCCGTCATG
NCSTN CCCTTCAGCATTACATCGCC 55 167
AACCCACGCGTACTCATACA
DES CCATCGCGGCTAAGAACATC 55 184
GAATCGTTGGTGCCCTTGAG
PAX6 TCAGCACCAGTGTCTACCAG 55 243
AGGTATCATAACTCCGCCCG
PTGS2 GCTGCGGGAACACAATAGAG 53 249
TGCCAGTGGTAGAGTGTGTT
MMP9 GCAAACCAATCTCACCGACA 53 223
GGTCAGAAATTTGCCCACGT
CCNB1 AGCGGATCCCAACCTTTGTA 53 248
GCATCTTCTTGGGCACACAA
CCNB2 AGTACCTGAGGCAGCTTGAG 53 231
GCAGAGCTGTAATCCCAACC
CXCL8 GTGAAGCTGCAGTTCTGTCA 53 151
CCTCTCTTCCATTGGCAAGC
IGFBP3 GCCAGCGCTACAAAGTAGAC 53 209
GCGGCACTGTTTCTTCTTGT
CCNA2 AGGAGAACATCAACCCCGAG 53 179
GGGAGGAACAGTGACATGCT
PLK1 CTCGACACGCCTTATCCTCT 53 206
GGGCTAGCTCATCACCTTCA
VEGFC CTCTCTCTCAAGGCCCCAAA 53 244
GGGTCATCTCCAGCGTTAGA
CKS2 GACAAGTACTTCGACGAGCAC 53 167
TGTGGTTCTGGCTCATGAATC
RRM2 TGCCTGCCTGATGTTCAAAC 53 182
GCATAAGTCTGTCTGCCACG
CDC20 AGAATCAGCCCGAAAACAGC 57 220
AGGGAAGGAATGTAACGGCA
TP3 GAGGACGCCAGTGGTAATCT 56 197
AGCGGCTTCTTCTTTTGTGG
IFK67 CCGTCATACCCAGCAGTGAA 56 208
CCTGGCGCTTTCTGGAATTT
PCNA CGGACACCTTGGCACTAGTA 56 215
CACCCCATCTTTTGCACAGG
CASP7 TCCTCTTTTGTCCCATCGCT 56 198
CTCGGCGTCTTTGTCTGTTC
S100A4 TTCCACAAGTACTCGGGCAA 56 242
TTATCCGGGAAGCCTTCGAA
VIM GATTCAGGAACAGCACGTCC 56 207
TTGGATTCTTGCTTCGCCTG
HSP47 CACTACAACTGCGAGCACTC 56 220
CCATGAAGCCTCGATTGTCC
ACTA2 TCTGGACGTACAACTGGCAT 56 195
GACAATCTCACGCTCAGCAG
ICAM1 TGATACCCTCCGGATTGTGG 56 247
ATTCTCCAGTCTACTCCGCG
LYVE1 ACAAACCCGCAGCTGAATTT 56 175
ACTTGGGGTTCGCGAAAATC
CLDN7 TGGCCACCAGATAGTCACAG 56 172
TGCACGATACCCAGTTTTGC
EPCAM AAACTGCTCTTTGAACGCGT 56 204
AGCCCCTTCTCATCACAGTC
CDH1 AGAGAACTTGGAGCACGTGA 56 229
AAAGGGAGACGTGTTAGGGG
International Journal of Stem Cells 2021;14:191-202 https://doi.org/10.15283/ijsc20213
© 2021 International Journal of Stem Cells