International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

Primer sequences

Name of primer Sequences
iNOS-F 5’ CCCTTCAATGGTTGGTACATGG 3’
iNOS-R 5’ CATTGATCTCCGTGACAGCC 3’
IL-6-F 5’ CACCACTGCCCGTAGATGAAG 3’
IL-6-R 5’ AGGGTACAGTCGTCGAACTCT 3’
TNF-α-F 5’ TGCTTGTTCCTCAGCCTCTT 3’
TNF-α-R 5’ CAGAGGGCTGATTAGAGAGAGGT 3’
IL-1β-F 5’ TGAGCCAAGACAGAAAACCCA 3’
IL-1β-R 5’ GGGACATGAGTAAGGTTCCTGTT 3’
Arg1-F 5’ CATGGGCAACCTGTGTCCTT 3’
Arg1-R 5’ CGATGTCTTTGGCAGATATGCA 3’
IL-10-F 5’ GAGATGCCTTCAGCAGAGTGAAGA 3’
IL-10-R 5’ AGTTCACATGCGCCTTGATGTC 3’
TGF-β-F 5’ GCGACTCGCCAGAGTGGTTA 3’
TGF-β-R 5’ GTTGATGTCCACTTGCAGTGTGTTA 3’
chi3l3-F 5’ TGGCCCACCAGGAAAGTACA 3’
chi3l3-R 5’ CAGTGGCTCCTTCATTCAGAAA 3’
GAPDH-F 5’ GTCGATGGCTAGTCGTAGCATCGAT 3’
GAPDH-R 5’ TGCTAGCTGGCATGCCCGATCGATC3’

F: forward, R: reverse.

International Journal of Stem Cells 2021;14:331-40 https://doi.org/10.15283/ijsc20156
© 2021 International Journal of Stem Cells