International Journal of Stem Cells : eISSN 2005-5447

Table. 2.

Table. 2.

Primers for quantitative RT-PCR

Genes Primers and probes (5’-3’)
human GAPDH Forward GGTGGTCTCCTCTGACTTCAACA
Reverse GTGGTCGTTGAGGGCAATG
human RUNX1 Forward CTTCACAAAACCCACCGCAAG
Reverse GGCTGAGGGTTAAAGGCAGT
human Wnt5A Forward CGCGAAGACCGGCATCAAAG
Reverse GCGCTGTCGTACTTCTCCTT
human Notch3 Forward CATCTCCGACCTGATCTGCC
Reverse CAAAGTGGTCCAACAGCAGC
human HLA-DQB1 Forward CGATGCTGAGCTCCCTACTG
Reverse GTAGACATCTCCACGCTGGG
human PU.1 Forward TCAGAAGACCTGGTGCCCTA
Reverse GTGCTTGGACGAGAACTGGA
human ID2 Forward GCAGATCGCCCTGGACTCGC
Reverse AGCCACACAGTGCTTTGCTGT
human E12 Forward ACAGTGGGCTAGGGCGAGCA
Reverse TCGGCCTTCTGCTCTGGGGG
International Journal of Stem Cells 2021;14:203-11 https://doi.org/10.15283/ijsc21015
© 2021 International Journal of Stem Cells