International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

List of genes and primer sequences

Gene Primer Primer (5’–3’)
Col1-A1 Forward GAGTGAGGCCACGCATGA
Reverse AGCCGGAGGTCCACAAAG
α-SMA Forward CCCCTGAAGAGCATCGGACA
Reverse TGGCGGGGACATTGAAGGT
Fibro Forward TACCAGAGGGGAAAAACGCC
Reverse GCAGCGGTACAGATCCGAATC
PAI-1 Forward CACAGGCACTGCAAAAGGTC
Reverse TGTGCCGAACCACAAAGAGA
Fsp1 Forward AGCTACTGACCAGGGAGCTG
Reverse CATTGTCCCTGTTGCTGTC
Axin2 Forward CGACGCACTGACCGACGATT
Reverse CGAAGGCAGCAGGTTCCACAG
GAPDH Forward CTGATGCCTCCATGTTTGTG
Reverse GGATGCAGGGATGATGTTCT
International Journal of Stem Cells 2021;14:310-9 https://doi.org/10.15283/ijsc20184
© 2021 International Journal of Stem Cells