International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

Primer sequences of RT-qPCR

Primer Sequences (5’-3’)
miR-324-5p F: ATTGTACGCATCCCCTAGGGC
R: CTCAACTGGTGTCGTGGA
TOLLIP F: ATGGCGACCACCGTCAGCACGCA
R: CTAGGACTCTTCGCCCATTTGCAG
U6 F: ATGGCGGACGACGTAGATCAGCA
R: TCAGCCAACTCTCAATGGAGGGGC
GAPDH F: ATGGTGAAGGTCGGTGTGAACGGA
R: TTACTCCTTGGAGGCCATGTAGGC

Note: RT-qPCR: reverse transcription-quantitative polymerase chain reaction, miR: microRNA, TOLLIP: Toll-interacting protein, GAPDH: glyceraldehyde-3-phosphate dehydrogenase, F: forward, R: reverse.

International Journal of Stem Cells 2021;14:298-309 https://doi.org/10.15283/ijsc21025
© 2021 International Journal of Stem Cells