International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

RT-qPCR primers

Target gene Forward primers, 5’-3’ Reverse primers, 5’-3’
miR-148a-3p TCAGTGCACTACAGAACTTTGT GAATACCTCGGACCCTGC
Wnt1 CGATGGTGGGGTATTGTGAAC CCGGATTTTGGCGTATCAGAC
DSPP TTTGGGCAGTAGCATGGGC CCATCTTGGGTATTCTCTTGCCT
DMP-1 CTCCGAGTTGGACGATGAGG TCATGCCTGCACTGTTCATTC
RUNX2 TGGTTACTGTCATGGCGGGTA TCTCAGATCGTTGAACCTTGCTA
OCN CACTCCTCGCCCTATTGGC CCCTCCTGCTTGGACACAAAG
Smad4 CTCATGTGATCTATGCCCGTC AGGTGATACAACTCGTTCGTAGT
β-catenin AAAGCGGCTGTTAGTCACTGG CGAGTCATTGCATACTGTCCAT
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
GAPDH AGGTCGGTGTGAACGGATTTG GGGGTCGTTGATGGCAACA
International Journal of Stem Cells 2021;14:434-46 https://doi.org/10.15283/ijsc20118
© 2021 International Journal of Stem Cells