International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

Sequences of real-time PCR primers

mRNA Primer Sequences (5’-3’) Annealing temperature
Human-IL-8 Forward AGCTCTGTGTGAAGGTGCAG 60℃
Reverse TCTCAGCCCTCTTCAAAAACTTC
Human-IL-6 Forward TTACAGGGAGAGGGAGCGAT 60℃
Reverse TTCTCTTTCGTTCCCGGTGG
Human-GM-CSF Forward TGGCCATGGAAAAGGGACTG 63℃
Reverse ACTGAGAGGCTGGTCCATCAGA
Human-VEGF Forward GTGACACCAGCTGTCTCCG 60℃
Reverse ACCCGTTGATCAGCAGAAGG
Human-OCT4 Forward TTGAGGCTCTGCAGCTTAG 60℃
Reverse GCCGGTTACAGAACCACAC
Human-SALL4 Forward TCGATGGCCAACTTCCTTC 62℃
Reverse GAGCGGACTCACACTGGAGA
LV3-homo-SOX9 GCATCCTTCAATTTCTGTATA
LV3NC TTCTCCGAACGTGTCACGT
Human-β-actin Forward GACCTGTACGCCAACACAGT 59℃
Reverse CTCAGGAGGAGCAATGATCT
International Journal of Stem Cells 2021;14:465-74 https://doi.org/10.15283/ijsc21078
© 2021 International Journal of Stem Cells