International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

Primer sequence

Primers Sequences (5’-3’)
miR-150-5p-F TCTCCCAACCCTTGTACCAGTG
miR-150-5p-R CAGTGCGTGTCGTGGAGT
U6-F CTCGCTTCGGCAGCACATATACT
U6-R ACGCTTCACGAATTTGCGTGTC
PTEN-F AAGACCATAACCCACCACAGC
PTEN-R ACCAGTTCGTCCCTTTCCAG
GAPDH-F AATGGGCAGCCGTTAGGAAA
GAPDH-R GCGCCCAATACGACCAAATC
International Journal of Stem Cells 2022;15:359-71 https://doi.org/10.15283/ijsc21135
© 2022 International Journal of Stem Cells