International Journal of Stem Cells : eISSN 2005-5447

Table. 2.

Table. 2.

Primer sequences and the size of amplicons

Gene Accession Direction Sequence (5’-3’) Size (bp) Annealing temperature (℃)
TUBB3 NM_006086.4 Forward GCCCAGTATGAGGGAGATCGTG 217 60
Reverse GGGTTCCAGGTCCACCAGAAT
NEFH NM_021076.4 Forward ATGCCGAATGCCACACGTAA 230 61
Reverse ACCTGGACCGCTCTTCCAGA
SLC17A7 NM_020309.4 Forward AAGCTAGCGGGTCGTGCT 81 61
Reverse ACTCAGCTCCAGCGTCTCC
SLC17A6 NM_020346.3 Forward ATTCCATCAGCAGCCAGAGT 107 58
Reverse TTGCTCCATATCCCATGACA
MAP2 NM_001375545.1 Forward CTGCTACAGCCTCAGCAGTGAC 94 63
Reverse GGGATCAACGGAGAGCTGACCT
GAPDH NM_001357943.2 Forward TGCCCTCAACGACCACTTTG 107 60
Reverse CTTACTCCTTGGAGGCCATGTG
International Journal of Stem Cells 2022;15:258-69 https://doi.org/10.15283/ijsc21217
© 2022 International Journal of Stem Cells