International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

qRT-PCR primers

Gene name Forward Reverse
GAPDH CATCACTGCCACCCAGAAGACTG ATGCCAGTGAGCTTCCCGTTCAG
OCT4 CAGCAGATCACTCACATCGCCA GCCTCATACTCTTCTCGTTGGG
NANOG GAACGCCTCATCAATGCCTGCA GAATCAGGGCTGCCTTGAAGAG
SOX2 AACGGCAGCTACAGCATGATGC CGAGCTGGTCATGGAGTTGTAC
CDX2 CATCAGGAGGAAAAGTGAGCTGG TTTTCCTCTCCTTGGCTCTGCG
SOX17 GCCGATGAACGCCTTTATGGTG TCTCTGCCAAGGTCAACGCCTT
FOXA2 CGAGCACCATTACGCCTTCAAC AGTGCATGACCTGTTCGTAGGC
HOXA13 CCCAAAGAGCAGACGCAGCCT GTGTAAGGCACGCGCTTCTTTC
HOXD13 ATCAGCCACAGGGGTCCCATTT GAGCTGCAGTTTGGTGTAAGGC
Uroplakin IA GGATTGCCATCTTCTGCGGCTT TGATGCAGGAGGCACACTCGAA
Uroplakin IB CCTGAAGCAGATGCTGATGAGG TGCCAGTCTGACGGACCGTTTA
Uroplakin II AGAGACTCCCATGTCCACGCTT CAGCACTGTGATGACCACCATC
UPK III GTTTCGCTGGAGCCATCATCCT CGGTTCACAGATGAGTAGGAAGG
Uroplakin IIIB GTGCTTCGGGTGGGCAATGATT TGGACCACTTCGTCTCAGCCTT
Cytokeratin 20 GGATTCGAGGTTCAAGTCACGG TCTAGGTTGCGCTCCAGAGACT
Cytokeratin 5 GAACAGAGGCTGAGTCCTGGTA TCTCAGCCTCTGGATCATTCGG
Cytokeratin 7 CGGAGATGAACCGCTCTATCCA CATGAGCATCCTTGATTGCCAGC
Cytokeratin 13 GACTGGCATCTGAAACAGAGCC TTGTCCGTGGTGGCTTCCAGAA
ZO-1 GTTGGTACGGTGCCCTGAAAGA GCTGACAGGTAGGACAGACGAT
E-cadherin GGTCATCAGTGTGCTCACCTCT GCTGTTGTGCTCAAGCCTTCAC
International Journal of Stem Cells 2022;15:347-58 https://doi.org/10.15283/ijsc21250
© 2022 International Journal of Stem Cells