International Journal of Stem Cells : eISSN 2005-5447

Table. 1.

Table. 1.

Primer information for RT-PCR

Genes Primer sequences Annealing temperature (℃) Cycle no. PCR product (bp)
OCT4 GCTGGATGTCAGGGCTCTTT 60 28 72
TCAAGAGATTTATCGAGCACCTTCT
GSC GAGGAGAAAGTGGAGGTCTGGTT 58 31 72
CTCTGATGAGGACCGCTTCTG
LMO2 CTACTACAAACTGGGCCGGAAG 60 31 117
ACCCGCATTGTCATCTCATAG
PAX6 ACACACATTAACACACTTGAGC 60 28 158
TGCTGTTGTTGCTTGAAGAC
GAPDH ACATCAAGAAGGTGGTGAAGCA 60 28 241
TCTTACTCCTTGGAGGCCATGT

RT-PCR: reverse transcription polymerase chain reaction.

International Journal of Stem Cells 2024;17:59-69 https://doi.org/10.15283/ijsc23037
© 2023 International Journal of Stem Cells