Search for


search for




 

Low-Intensity Pulsed Ultrasound Promotes BMP9 Induced Osteoblastic Differentiation in Rat Dedifferentiated Fat Cells
International Journal of Stem Cells 2023;16:406-414
Published online November 30, 2023;  
© 2023 Korean Society for Stem Cell Research.

Fumiaki Setoguchi1, Kotaro Sena1,2, Kazuyuki Noguchi1

1Department of Periodontology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan
2Division of Preventive Dentistry, Department of Community Social Dentistry, Graduate School of Dentistry, Tohoku University, Miyagi, Japan
Correspondence to: Kotaro Sena
Division of Preventive Dentistry, Department of Community Social Dentistry, Graduate School of Dentistry, Tohoku University, 4-1 Seiryo-machi, Aoba-ku, Sendai-city, Miyagi 980-8575, Japan
E-mail: sena@tohoku.ac.jp
Received March 11, 2023; Revised May 24, 2023; Accepted May 25, 2023.
This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Dedifferentiated fat cells (DFATs) isolated from mature adipocytes have a multilineage differentiation capacity similar to mesenchymal stem cells and are considered as promising source of cells for tissue engineering. Bone morphogenetic protein 9 (BMP9) and low-intensity pulsed ultrasound (LIPUS) have been reported to stimulate bone formation both in vitro and in vivo. However, the combined effect of BMP9 and LIPUS on osteoblastic differentiation of DFATs has not been studied. After preparing DFATs from mature adipose tissue from rats, DFATs were treated with different doses of BMP9 and/or LIPUS. The effects on osteoblastic differentiation were assessed by changes in alkaline phosphatase (ALP) activity, mineralization/calcium deposition, and expression of bone related genes; Runx2, osterix, osteopontin. No significant differences for ALP activity, mineralization deposition, as well as expression for bone related genes were observed by LIPUS treatment alone while treatment with BMP9 induced osteoblastic differentiation of DFATs in a dose dependent manner. Further, co-treatment with BMP9 and LIPUS significantly increased osteoblastic differentiation of DFATs compared to those treated with BMP9 alone. In addition, upregulation for BMP9-receptor genes was observed by LIPUS treatment. Indomethacin, an inhibitor of prostaglandin synthesis, significantly inhibited the synergistic effect of BMP9 and LIPUS co-stimulation on osteoblastic differentiation of DFATs. LIPUS promotes BMP9 induced osteoblastic differentiation of DFATs in vitro and prostaglandins may be involved in this mechanism.
Keywords : Dedifferentiated fat cells, Bone morphogenetic protein 9, Low-intensity pulsed ultrasound, Prostaglandins
Introduction

Bone tissue engineering is an effective method to treat large bone defects after trauma, peri-implantitis, and periodontitis. Cells are an important component for tissue engineering and mesenchymal stem cells (MSCs) have been considered suitable for tissue engineering and rege-neration because of their high proliferative potential and ability to differentiate into several linages, including bone forming cells (i.e. osteoprogenitors, osteoblasts). Despite the promising results from preclinical studies, issues such as heterogeneity of cells as well as the need to undergo invasive procedure and ex vivo expansion to obtain enough cells related have limited the application of MSCs in clinical practice, fostering the search for alternative cells through a minimally invasive approach. It has been demonstrated that dedifferentiated fat cells (DFATs) isolated from mature adipocytes by the ceiling culture method have multilineage differentiation capacity (1, 2). For bone formation, DFATs have been reported to show higher expression level of osteoblastic genes, alkaline phosphatase activity, and calcium deposition than bone narrow derived MSCs in vitro (3). Furthermore, DFATs have been successfully prepared from donors aged 4∼81 years and can be obtained regardless of the donor’s age (1). Therefore, DFATs are a promising cell source for tissue engineering.

Bone morphogenetic proteins (BMPs) belong to the transforming growth factor TGF-β superfamily and regulate bone formation, angiogenesis, neurogenesis, as well as development of multiple organ systems (4). Among several members of BMPs, BMP2 and BMP7 have been characterized for higher osteogenic effects than other BMPs. Indeed, BMP2 is currently used in clinics for treating large bone defect and fracture (5, 6). BMP9, also known as growth differentiation factor 2, was originally identified in fetal mouse liver and recent studies found that BMP9 is more osteoinductive than BMP2 (7, 8). BMP9 has different characteristics to other BMPs including resistance to the inhibitors noggin and BMP3 (9).

Low-intensity pulsed ultrasound (LIPUS) is a FDA-approved non-invasive intervention which has been clinically applied in the treatment of intractable fracture and non-unions by stimulating cell proliferation, angiogenesis, extracellular matrix production and inflammation suppre-ssion (10-13). At the cellular level, it has been reported that LIPUS stimulus is converted into biological signaling through integrins on the cell surface and subsequently upregulates prostaglandin E2 (PGE2) and cyclooxygenase 2 (COX2) expression, which promotes osteogenesis in osteoblasts (14, 15).

A previous study showed that osteoblastic differen-tiation of DFATs was significantly induced by BMP9 and co-stimulation with additional agents such as FK506 (16). Furthermore, combination of BMP9 and LIPUS resulted in higher bone formation compared to the carrier/collagen sponge only-group in rat calvarial bone defects, in vivo (17). However, the combined effect of BMP9 and LIPUS on osteoblastic differentiation of DFATs has not been stu-died, so far. Therefore, the aim of this study was to examine the effects of BMP9 and LIPUS co-stimulation on osteoblastic differentiation of rat DFATs.

Materials and Methods

Reagents

Recombinant human BMP9 was purchased from FUJI-FILM Wako (Osaka, Japan) and an inhibitor for prostaglandin synthesis; indomethacin, and Prostaglandin E2 ELISA Kit were purchased from Cayman Chemical (Ann Arbor, MI).

Isolation and culture of DFATs

All animal experiments were approved by the Ethical Committee of the Animal Research Center of Kagoshima University (Approval No. D19039). Isolation of DFATs from mature adipose tissue was performed by the ceiling culture method as previously described by Jumabay et al. (18), with minor modification (16). In brief, 9∼10-week-old male Wister rats were purchased from Charles River Labo-ratories (Kanagawa, Japan). Mature adipose tissue (2 g) was removed from the inguinal region of the rat and min-ced followed by digestion using 0.2% collagenase I solution (Invitrogen, Carlsbad, CA) at 37℃ for 45 min with gentle shaking. These cells were filtrated through 140 μm mesh (Sigma-Aldrich, St. Louis, MO) and centrifuged at 135 g for 3 min. The top layer, a suspension of adipocytes, was washed with phosphate-buffered saline (PBS) and centrifuged three times. The cells were cultured in a 25 cm2 tissue culture flask filled completely with Dulbecco’s modified Eagle’s medium (DMEM; Sigma-Aldrich, St. Louis, MO) containing 20% fetal bovine serum (FBS) and antibiotics (100 U/ml penicillin G and 100 μg/ml streptomycin) in this floating condition at 37℃ in 5% CO2. After 1 week, the fibroblast like cells attached to the upper surface of the flasks. The medium was removed, and the flasks were inverted. The adherent cells were cultured in growth culture medium (DMEM supplemented with 10% FBS and antibiotics). DFATs were subcultured and used for experiments at passages 3∼7. For osteogenic differentiation, the cells were cultured in osteogenic differentiation medium (ODM) consisting of DMEM supplemented with 10% FBS, antibiotics, 10 mM β-glycerophosphate, 10 μg/ml ascorbic acid, and 10 μM all-trans retinoic acid (first 3 days only).

LIPUS application

DFATs were stimulated by a LIPUS exposure device (Teijin Pharma, Tokyo, Japan) consisting of an array of six transducers designed for a 6 well culture plate. Ultra-sound transducers were placed under the bottom of each well using a coupling gel (19). The LIPUS signal consisted of a 1.5 MHz, 200 μs burst sine wave with repetition rate at 1.0 kHz and was delivered at an intensity of 30 mW/cm2 spatial and temporal average (SATA). The cells were exposed to LIPUS for 20 min every day. Non-LIPUS-treated cells were handled in the same way using separate culture plates, but the ultrasound generator was not switched on.

ALP activity and Alizarin red S staining

DFATs were seeded at a density of 2×104 cells/cm2 in 6 well culture plates. Cells were cultured for 6 d for ALP activity assay. After 6 d, cells were washed twice with PBS, sonicated 10 s on ice and scraped off with lysis buffer (1.5 M Tris-HCl at pH 9.2, 1 mM MgCl2-6H2O, and 1% Triton X-100). ALP activity was measured as described previously and measured values were corrected by total protein content (16). For the mineralization assay, DFATs were cultured for 21 d. After 21 d, cells were fixed in 3.7% formaldehyde neutral buffer and stained with alizarin red S. Images of the stained plates were acquired by using a scanner. Further, quantification of the alizarin red S dye was performed by extraction with 10% cetylpyridinium chloride/10 mM sodium phosphate solution followed by measurement with microplate reader at a wavelength of 562 nm (20).

Real-time PCR analysis

For real-time PCR, cells were cultured for 2 d or 6 d. Total RNA was extracted from DFATs using TRIzol reagent (Life Technologies, Grand Island, NY) according to the manufacturer’s instructions. Total RNA was used as the template to synthesize cDNA by the ReverTra Ace qPCR RT kit (Toyobo, Osaka, Japan). Quantitative gene-expression analyses were carried out using real-time PCR by means of the Thunderbird SYBR qPCR mix (Toyobo, Osaka, Japan) and the Real-time PCR System 7300 (App-lied Biosystems, Foster City, CA) as previously described (21). The PCR amplifications were carried out under the following conditions: 95℃ for 30 s, followed by 40 cycles of 95℃ for 15 s, 60℃ for 35 s. We used the comparative Ct method to calculate the relative mRNA expression. All quantitation was normalized by the corresponding GAPDH expression. Information for the primer sets is listed in Table 1.

Table 1 . The sequences for primers used in present research

GeneForward (5’<-----> 3’)Reverse (5’<-----> 3’)Size
(bp)		Accession number
ALK-1CGTGCTGGTCAAGAGCAACTGCTTTGCGAGTGCATCACA69NM_022441.2
ALK-2GGAAGTGGCCAGGAGGATGGGTCATTGGGAACAACATC80NM_024486
BMP receptor IICCCCGAGGAGATCATTACAAACGTGCCACCATTCTTTACC81NM_080407.1
EndoglinGCTGCGGCATGAAAGTGAGGTAAGCCTGATGGCAAATTG69NM_001010968.3
GapdhCGGCAAGTTCAACGGCACAGTCAAGGACGACATACTCAGCACCAGCATCACC129NM_017008.4
OpnGATGAACCAAGCGTGGAAACTGAAACTCGTGGCTCTGATG200NM_012881.2
OsxCCCTTTCCCCACTCATTTCCCTGCCCACCACCTAACCAA237NM_001173467.3
Runx2ACAACCACAGAACCACAAGTCTCGGTGGCTGGTAGTGA105NM_001278483.1

Prostaglandin E2 assay

The media from DFATs was collected 24 h after treatment with LIPUS and stored at −80℃. The levels of prostaglandin E2 (PGE2) produced by DFATs in the culture media were quantified using a commercially available ELISA kit (Prostaglandin E2, EIA Monoclonal Kit; Cayman Chemical, Ann Arbor, MI), in accordance with the manufacturer’s instructions.

Statistical analysis

All experiments were conducted independently for DFATs from two different donor animals and similar results were obtained. All experiments were repeated at least twice. The statistical significance of differences between treatment groups was analyzed by one-way ANOVA and Bonferroni-Dunn test (IBM SPSS Statistics; IBM SPSS, Chicago, IL). Values of p<0.05 were considered to be statistically significant.

Results

ALP activity of DFATs stimulated with BMP9 and/or LIPUS

We examined the effects of BMP9 and LIPUS alone or in combination on ALP activity in DFATs. LIPUS alone (without BMP9) did not affect ALP activity of DFATs at 6 d. BMP9 (0.1∼100 ng/ml) enhanced ALP activity of DFATs in a dose-dependent manner, with 100 ng/ml of BMP9 inducing the highest ALP activity. In the presence of BMP9 at 10 ng/ml or higher, significantly higher ALP activity (p<0.05) was noted in the LIPUS-stimulated group compared to the non-LIPUS-stimulated group (Fig. 1).

Figure 1. ALP activity of DFATs stimulated with BMP9 and/or LIPUS. DFATs were seeded at a density of 2×104 cells/cm2 in CM. After 24 h of incubation, cells were cultured with BMP9 (0∼100 ng/ml) for 6 days in ODM. LIPUS treated cells were exposed to LIPUS for 20 minutes every day. Enhanced ALP activity by LIPUS treatment was observed in DFATs with BMP9 concentrations at 10 ng/ml or higher. Data represent means±SD (n=4). *p<0.05 vs. LIPUS (-) 100 ng/ml. #p<0.05 vs. LIPUS (-) 10 ng/ml.

Mineralization of DFATs stimulated with BMP9 and/or LIPUS

Effects of BMP9 and LIPUS on mineralization in DFATs were examined at 21 days. In doses less than 10 ng/ml of BMP9, DFATs were not stained by Alizarin red S, but at 100 ng/ml, calcium deposits were detected in both sham and LIPUS stimulated groups (Fig. 2A). Quantified result of Alizarin red S stain indicated no significant difference in doses less than 10 ng/ml of BMP9, while at 100 ng/ml, mineralization was significantly enhanced in the LIPUS-stimulated group compared to the sham group (p<0.05, Fig. 2B).

Figure 2. Mineralization of DFATs treated with BMP9 and/or LIPUS. (A) Alizarin red S staining. (B) Quantification of Alizarin red S staining. The cells were cultured with BMP9 (0∼100 ng/ml) for 21 days in ODM. LIPUS treated cells were exposed to LIPUS for 20 minutes every day. Intense Alizarin red S staining was observed in DFATs treated with BMP9 concentrations at 100 ng/ml and higher amount of stain was noted by co-treatment with LIPUS. Values are shown as mean±SD (n=4). *p<0.05 vs. LIPUS (-) 100 ng/ml.

mRNA expression of bone-related genes in DFATs stimulated with BMP9 and/or LIPUS

The expression of bone-related genes, including Runx2, osterix (Osx), and osteopontin (Opn) was investigated by quantitative PCR. Runx2 and Osx were analyzed at 2 d and Opn at 6 d. Results for all genes showed a tendency toward an increase in gene expression level in a dose-dependent manner for BMP9. For all genes, including Runx2, Osx, and Opn, a significantly higher level of gene expression was observed in combination of BMP9 at 100 ng/ml and LIPUS compared to BMP9 at 100 ng/ml alone (Fig. 3). Thus, we decided to use 100 ng/ml of BMP9 for the following experiments.

Figure 3. mRNA expression of bone-related genes in DFATs treated with BMP9 and/or LIPUS. (A∼C) The effects of BMP9 and/or LIPUS treatment on the expression of bone-related genes (Runx2, Osx, Opn) were analyzed by quantitative real-time PCR. The cells were cultured with BMP9 (0∼100 ng/ml) for 2 days (A, B) and 6 days (C) in ODM. LIPUS treated cells were exposed to LIPUS for 20 minutes every day. Values are shown as mean±SD (n=3). **p<0.01 vs. LIPUS (-) 100 ng/ml.

Expression of BMP9 receptor genes in DFATs stimulated with BMP9 and/or LIPUS

BMP9 binds to activin receptor-like kinase -1 (ALK1), -2 (ALK-2) and BMP receptor II with high affinity. In addition, endoglin is known to act as a co-receptor. Here, we examined the effect of BMP9 and/or LIPUS on expression of BMP9-related-receptor genes in DFATs. Two days after LIPUS treatment, expression of BMP9-related-receptor genes was investigated by real-time PCR. The expression level for ALK-1, ALK-2, BMP receptor II and Endoglin was significantly higher in the BMP9 stimulated group than ODM group (Fig. 4). The expression for all BMP9-related-receptor genes elevated by BMP9 was further enhanced by LIPUS stimulation (Fig. 4).

Figure 4. Expression of BMP9-related receptor genes in DFATs treated with BMP9 and/or LIPUS. (A∼D) The expression of (A) ALK-1, (B) ALK-2, (C) BMP receptor II and (D) Endoglin in DFATs analyzed by real-time PCR. The cells were cultured with BMP9 (100 ng/ml) for 2 days in ODM. LIPUS treated cells were exposed to LIPUS for 20 minutes every day. Values are shown as mean±SD (n=4). *p<0.05, **p<0.01.

Effects of indomethacin on DFATs stimulated with BMP9 and/or LIPUS

As it has previously been reported that PGE2 plays an important role during bone remodeling (10), we examined the effects of an inhibitor for prostaglandin synthesis, indomethacin, by ALP activity and expression of bone-related genes in DFATs after stimulation with BMP9 and/or LIPUS. For ALP activity, no significant effect of indomethacin was observed in the non-LIPUS-treated group, but in the LIPUS-stimulated groups, addition of indomethacin significantly suppressed ALP activity level induced by BMP9 (Fig. 5A). On the other hand, for the expression of bone-related genes in the LIPUS-stimulated group, the addition of indomethacin significantly suppressed the expression of Runx2 and Opn (Fig. 5B and 5D) but showed a slight decrease, although not significantly for Osx (Fig. 5C).

Figure 5. Effects of indomethacin on ALP activity and mRNA levels of bone-related genes in DFATs treated with BMP9 and/or LIPUS. (A) The effect of indomethacin on ALP activity. (B∼D) The effect of indomethacin on expression of bone-related genes; (B) Runx2, (C) Osx, (D) Opn. DFATs were cultured with BMP9 (100 ng/ml) and indomethacin (1 μM) for 2 days (A∼C) and 6 days (D) in ODM. LIPUS treated cells were exposed to LIPUS for 20 minutes every day. Values are shown as mean±SD (n=4). **p<0.01.

Release of PGE2 from DFATs stimulated with BMP9 and/or LIPUS and effect of indomethacin

Next, we analyzed the effect on BMP9 and/or LIPUS treatment on PGE2 production by DFATs. BMP9 significantly increased PGE2 production and addition of indomethacin significantly suppressed the release of BMP9-induced PGE2 (Fig. 6). The addition of LIPUS significantly enhanced the PGE2 production induced by BMP9 which was suppressed by indomethacin.

Figure 6. Release of PGE2 from DFATs treated with BMP9 and/or LIPUS and effect of indomethacin. DFATs were stimulated with BMP9 and/or LIPUS in ODM. Some samples were treated with indomethacin. The cells were cultured with BMP9 (100 ng/ml) and indomethacin (1 μM) for 24 h in ODM. LIPUS treated cells were exposed to LIPUS for 20 minutes every day. Values are shown as mean±SD (n=4). **p<0.01.
Discussion

A previous study showed BMP9 led to differentiation of DFATs into the osteoblastic linage (16). The present study evaluated the combined effect of BMP9 and LIPUS on osteoblastic differentiation of DFATs in vitro. Although LIPUS treatment has been reported to stimulate osteoblastic differentiation of human periodontal ligament stem cells (22), as well as murine stromal cells (23), LIPUS alone did not induce DFATs to differentiate into the osteoblastic linage. This may be due to different cell types used to study the effect of LIPUS on its inductive effect to differentiate to the osteoblastic linage. Indeed, a previous report comparing response of bone- and bone marrow-derived primary cells to LIPUS by Naruse et al. noted that non-differentiated bone marrow-derived adherent cells obtained from rat femora were insensitive to LIPUS compared to osteoblasts and osteocytes (24). In their study, no significant change in mRNA levels of COX2 (an upstream enzyme for prostaglandin production) as well as other bone proteins were detected in bone marrow-derived adherent cells after LIPUS treatment while higher expre-ssion level was observed in osteoblasts and osteocytes. Our results suggest that non-differentiated DFATs may be insensitive to LIPUS similar to that non-differentiated bone marrow-derived adherent cells.

Co-treatment with BMP9 and LIPUS synergistically induced osteoblastic differentiation of DFATs with enhancement of ALP level, the amount of calcium deposition and expression levels for bone related genes, compared to individual stimulation by BMP or LIPUS. Sant’Anna et al. (25) studied the combined effect of BMP2 and LIPUS in rat bone marrow stromal cells and reported changes in the temporal expression patterns of osteogenic genes indicating differences in signal transduction pathways by the stimulus. Lai et al. (26) reported that no significant differences in expression of bone related genes among human MSCs treated with LIPUS or BMP2 alone and as co-treatments. Recently, a study by Han et al. (27) repor-ted co-treatment of rat mesenchymal stem cells with BMP2 and LIPUS led to enhanced ALP activity compared to LIPUS alone or BMP2 alone. In vivo, it has also been reported that the co-stimulation with BMP2 and LIPUS enhanced bone formation (28, 29). In addition, we recently reported that that LIPUS promoted BMP9-induced bone formation in a rat calvarial bone defect (17). Our current finding may provide promising support for utilizing DFATs with co-treatment of BMP9 and LIPUS for effective bone tissue engineering. One noteworthy finding in the present study is that the DFATs co-treated with 10 ng/ml of BMP9 and LIPUS showed similar ALP activity to those treated with 100 ng/ml of BMP9 (without LIPUS). Although the results from the mineralization assay did not show a similar effect, combined use of BMP9 and LIPUS may allow for the use of a smaller (1/10) concentration of BMP9.

BMPs are known to transduce signals through a receptor complex consisting of serine/threonine kinases, including two type I receptors and two type II receptors on the cell membrane (30). Especially, BMP9 was reported to have high binding affinity to type I receptors; ALK-1 and ALK-2, type II receptor; BMP receptor II, and co-receptor; endoglin (31, 32). We showed that expression levels for ALK-1, ALK-2, and BMP receptor II gene were upregulated by LIPUS stimulation while BMP9 stimulation upregulated the expression of all BMP9-related receptor genes analyzed. By co-stimulation of DFATs with BMP9 and LIPUS, significantly higher mRNA levels for ALK-1, ALK-2, BMP receptor II and endoglin were observed compared to BMP9 alone (without LIPUS). These results suggest that LIPUS may enhance the responses of DFATs to BMP9 by upregulating the expression of its receptors. Our finding on increased expression of BMP receptor genes by LIPUS stimulation is also in agreement with a previous study which reported elevated expression of BMP receptor genes by LIPUS treatment in osteoblasts (33). Similarly, a more recent study utilizing the rabbit distraction osteogenesis model reported that the application of BMP2 after LIPUS pretreatment led to greater bone volume than the application of BMP2 before LIPUS treatment, in vivo (27). Toge-ther with our current findings, it is likely that the synergistic effect of BMPs and LIPUS application in osteobla-stic differentiation or bone formation may by regulated through enhancing the availability of BMP receptors by LIPUS stimulation. Further investigation is necessary to elucidate how LIPUS upregulates the expression of BMP receptors and whether enhancing the number or availability of BMP receptors in DFATs modulates the function of BMPs on these cells.

Prostaglandins are known as biologically active substances produced from arachidonic acid via cyclooxyge-nases. In particular, PGE2 has been known to play an important role in bone metabolism, being involved in both bone resorption and bone formation (34). In this study, indomethacin significantly suppressed elevated ALP activity induced by BMP9 and LIPUS co-stimulation (Fig. 5A) while such an effect was not observed in the non-LIPUS stimulated groups. Similarly, higher expression level for Runx2 and Opn in the BMP9 and LIPUS co-stimulation group was significantly inhibited by indomethacin (Fig. 5B and 5D). These results suggest involvement of prostaglandins in osteoblastic differentiation of DFATs. Since no significant inhibition of osteoblastic differentiation was observed in the sham group, indomethacin may counteract the osteoblastic differentiation promoted by LIPUS stimulation in BMP treated DFATs. From the ELISA results, increased release of PGE2 was observed after treating DFATs with BMP9 (Fig. 6). LIPUS co-stimulation significantly increased the release of PGE2 and the addition of indomethacin significantly suppressed the release. These results indicate that the synergistic effect of LIPUS treatment on BMP9 induced osteoblastic differentiation of DFATs is mediated via PGE2. Indeed, together with COX2, PGE2 have been strongly suggested as key downstream molecules stimulated by LIPUS stimulation (35). It has been demonstrated that LIPUS stimulates PGE2 synthesis from murine long bone osteocyte-like cells (36). In addition, secretion of PGE2 was significantly upregulated over 24 h after a single 20 min application of LIPUS in murine bone marrow-derived cells (24) and murine osteoblasts (15). Moreover, by treating the DFATs with PGE2 at different concentration, significantly low ALP level was observed at 0.1 nM (=35.25 pg/ml) PGE2 treatment, compared to 0 nM, while no difference was observed at 1 nM and significantly higher ALP level was observed after 10 nM (=3.525 ng/ml), 100 nM (=35.25 ng/ml), and 1,000 nM (=352.5 ng/ml) PGE2 treatment (Supplementary Fig. S1). In our study, the concentration of PGE2 in the culture medium of DFATs was less than 10 nM (between 50 pg/ml and 500 pg/ml, Fig. 6). For this, significant increase in osteoblastic differentiation of DFATs after BMP9 and LIPUS co-treatment cannot be explained by the concentration of PGE2. However, involvement of PGE2 is evident as indicated by the inhibitory effect of indomethacin. Additionally, Takiguchi et al. (37) reported co-treatment of human periodontal ligament cells with bone morphogenetic protein 2 (BMP2) and PGE2 within concentration between 10−10 M (0.1 nM) and 10−8 M (10 nM) showed higher osteoblastic differentiation compared to the cells treated with BMP2 alone by ALP activity. Taken together, the level of PGE2 observed in our study may not be enough to promote osteoblastic differentiation of DFATs only by PGE2 but may be enough to stimulate BMP-induced osteoblastic differentiation.

Application of DFATs has been shown to be promising for bone repair in several preclinical studies (38-40). Kikuta et al. (38) have reported that autologous transplantation of osteoblastic differentiated DFATs with beta-tricalcium phosphates/collagen sponge promoted bone regeneration in a rabbit tibial defect model. Tateno et al. (39) showed significant bone regeneration by transplanting DFATs combined with a biodegradable type I collagen recombinant peptide scaffold in a rat mandible defect model. In addition, our group also reported poly lactic-co-glycolic acid/hydroxyapatite as an effective carrier for bone formation utilizing DFATs in a rat calvarial defect (40). These reports suggest that DFATs may be a promising cell source for bone tissue engineering. Imafuji et al. (17) recently reported combination of BMP9 and LIPUS resulted in a higher bone formation compared to the carrier/collagen sponge only-group in rat calvarial bone defects. Taken together, in addition to combination of DFATs and BMP9 with an appropriate scaffold, LIPUS stimulation may promote bone formation, suggesting a novel strategy for bone tissue engineering in treating large bone defects.

In conclusion, we have found that LIPUS promotes BMP9 induced osteoblastic differentiation of DFATs in vitro, possibly via PGE2 and modulation of BMP9-related-receptors are suggested to be involved in this mechanism. Our findings may lead to the use of DFATs in combination with BMP9 and LIPUS for future bone tissue engineering approaches to treat large bone defects.

Acknowledgments

This work was supported by JSPS KAKENHI, Grant-in-Aid for Scientific Research (C), Grant Numbers JP18K09639, JP19K10169, JP21K09954, JP22K10039. The LIPUS equi-pment was provided by Teijin Pharma (Tokyo, Japan). We thank Dr. Yuko Mikuni-Takagaki (Kanagawa Dental Collage) and Mr. Yasuki Hanaoka (Teijin Pharma) for their support.

Potential Conflict of Interest

The authors have no conflicting financial interest.

Supplementary Materials

Supplementary data including one figure can be found with this article online at https://doi.org/10.15283/ijsc23027

References
  1. Matsumoto T, Kano K, Kondo D, Fukuda N, Iribe Y, Tanaka N, Matsubara Y, Sakuma T, Satomi A, Otaki M, Ryu J, Mugishima H. Mature adipocyte-derived dedifferentiated fat cells exhibit multilineage potential. J Cell Physiol 2008;215:210-222.
    Pubmed CrossRef
  2. Saler M, Caliogna L, Botta L, Benazzo F, Riva F, Gastaldi G. hASC and DFAT, multipotent stem cells for regenera-tive medicine: a comparison of their potential differentia-tion in vitro. Int J Mol Sci 2017;18:2699.
    Pubmed KoreaMed CrossRef
  3. Sakamoto F, Hashimoto Y, Kishimoto N, Honda Y, Matsu-moto N. The utility of human dedifferentiated fat cells in bone tissue engineering in vitro. Cytotechnology 2015;67:75-84.
    Pubmed KoreaMed CrossRef
  4. Bragdon B, Moseychuk O, Saldanha S, King D, Julian J, Nohe A. Bone morphogenetic proteins: a critical review. Cell Signal 2011;23:609-620.
    Pubmed CrossRef
  5. Cheng SL, Lou J, Wright NM, Lai CF, Avioli LV, Riew KD. In Vitro andIn Vivo induction of bone formation using a recombinant adenoviral vector carrying the human BMP-2 gene. Calcif Tissue Int 2001;68:87-94.
    Pubmed CrossRef
  6. Krebsbach PH, Gu K, Franceschi RT, Rutherford RB. Gene therapy-directed osteogenesis: BMP-7-transduced human fibroblasts form bone in vivo. Hum Gene Ther 2000;11:1201-1210.
    Pubmed CrossRef
  7. Kang Q, Sun MH, Cheng H, Peng Y, Montag AG, Deyrup AT, Jiang W, Luu HH, Luo J, Szatkowski JP, Vanichakarn P, Park JY, Li Y, Haydon RC, He TC. Characterization of the distinct orthotopic bone-forming activity of 14 BMPs using recombinant adenovirus-mediated gene delivery. Gene Ther 2004;11:1312-1320.
    Pubmed CrossRef
  8. Cheng H, Jiang W, Phillips FM, Haydon RC, Peng Y, Zhou L, Luu HH, An N, Breyer B, Vanichakarn P, Szatko-wski JP, Park JY, He TC. Osteogenic activity of the fourteen types of human bone morphogenetic proteins (BMPs). J Bone Joint Surg Am 2003;85:1544-1552.
    Pubmed CrossRef
  9. Wang Y, Hong S, Li M, Zhang J, Bi Y, He Y, Liu X, Nan G, Su Y, Zhu G, Li R, Zhang W, Wang J, Zhang H, Kong Y, Shui W, Wu N, He Y, Chen X, Luu HH, Haydon RC, Shi LL, He TC, Qin J. Noggin resistance contributes to the potent osteogenic capability of BMP9 in mesenchymal stem cells. J Orthop Res 2013;31:1796-1803.
    Pubmed CrossRef
  10. Doan N, Reher P, Meghji S, Harris M. In vitro effects of therapeutic ultrasound on cell proliferation, protein synthesis, and cytokine production by human fibroblasts, osteoblasts, and monocytes. J Oral Maxillofac Surg 1999;57:409-419; discussion 420.
    Pubmed CrossRef
  11. Xie S, Jiang X, Wang R, Xie S, Hua Y, Zhou S, Yang Y, Zhang J. Low-intensity pulsed ultrasound promotes the proliferation of human bone mesenchymal stem cells by activating PI3K/AKt signaling pathways. J Cell Biochem 2019;120:15823-15833.
    Pubmed CrossRef
  12. Li H, Zhou J, Zhu M, Ying S, Li L, Chen D, Li J, Song J. Low-intensity pulsed ultrasound promotes the formation of periodontal ligament stem cell sheets and ectopic periodontal tissue regeneration. J Biomed Mater Res A 2021;109:1101-1112.
    Pubmed CrossRef
  13. Busse JW, Bhandari M, Kulkarni AV, Tunks E. The effect of low-intensity pulsed ultrasound therapy on time to fracture healing: a meta-analysis. CMAJ 2002;166:437-441.
  14. Kokubu T, Matsui N, Fujioka H, Tsunoda M, Mizuno K. Low intensity pulsed ultrasound exposure increases prostaglandin E2 production via the induction of cyclooxygenase-2 mRNA in mouse osteoblasts. Biochem Biophys Res Commun 1999;256:284-287.
    Pubmed CrossRef
  15. Tang CH, Yang RS, Huang TH, Lu DY, Chuang WJ, Huang TF, Fu WM. Ultrasound stimulates cyclooxygenase-2 expression and increases bone formation through integrin, focal adhesion kinase, phosphatidylinositol 3-kinase, and Akt pathway in osteoblasts. Mol Pharmacol 2006;69:2047-2057.
    Pubmed CrossRef
  16. Nakamura T, Shinohara Y, Momozaki S, Yoshimoto T, Noguchi K. Co-stimulation with bone morphogenetic protein-9 and FK506 induces remarkable osteoblastic differentiation in rat dedifferentiated fat cells. Biochem Biophys Res Commun 2013;440:289-294.
    Pubmed CrossRef
  17. Imafuji T, Shirakata Y, Shinohara Y, Nakamura T, Noguchi K. Enhanced bone formation of calvarial bone defects by low-intensity pulsed ultrasound and recombinant human bone morphogenetic protein-9: a preliminary experimental study in rats. Clin Oral Investig 2021;25:5917-5927.
    Pubmed CrossRef
  18. Jumabay M, Matsumoto T, Yokoyama S, Kano K, Kusumi Y, Masuko T, Mitsumata M, Saito S, Hirayama A, Mugishima H, Fukuda N. Dedifferentiated fat cells convert to cardiomyocyte phenotype and repair infarcted cardiac tissue in rats. J Mol Cell Cardiol 2009;47:565-575.
    Pubmed CrossRef
  19. Sena K, Leven RM, Mazhar K, Sumner DR, Virdi AS. Early gene response to low-intensity pulsed ultrasound in rat osteoblastic cells. Ultrasound Med Biol 2005;31:703-708.
    Pubmed CrossRef
  20. Angle SR, Sena K, Sumner DR, Virdi AS. Osteogenic differentiation of rat bone marrow stromal cells by various intensities of low-intensity pulsed ultrasound. Ultrasonics 2011;51:281-288.
    Pubmed CrossRef
  21. Sakoda K, Nakajima Y, Noguchi K. Enamel matrix derivative induces production of vascular endothelial cell growth factor in human gingival fibroblasts. Eur J Oral Sci 2012;120:513-519.
    Pubmed CrossRef
  22. Chen D, Xiang M, Gong Y, Xu L, Zhang T, He Y, Zhou M, Xin L, Li J, Song J. LIPUS promotes FOXO1 accumulation by downregulating miR-182 to enhance osteogenic differentiation in hPDLCs. Biochimie 2019;165:219-228.
    Pubmed CrossRef
  23. Kusuyama J, Bandow K, Shamoto M, Kakimoto K, Ohnishi T, Matsuguchi T. Low intensity pulsed ultrasound (LIPUS) influences the multilineage differentiation of mesenchymal stem and progenitor cell lines through ROCK-Cot/Tpl2-MEK-ERK signaling pathway. J Biol Chem 2014;289:10330-10344.
    Pubmed KoreaMed CrossRef
  24. Naruse K, Miyauchi A, Itoman M, Mikuni-Takagaki Y. Distinct anabolic response of osteoblast to low-intensity pulsed ultrasound. J Bone Miner Res 2003;18:360-369.
    Pubmed CrossRef
  25. Sant'Anna EF, Leven RM, Virdi AS, Sumner DR. Effect of low intensity pulsed ultrasound and BMP-2 on rat bone marrow stromal cell gene expression. J Orthop Res 2005;23:646-652.
    Pubmed CrossRef
  26. Lai CH, Chen SC, Chiu LH, Yang CB, Tsai YH, Zuo CS, Chang WH, Lai WF. Effects of low-intensity pulsed ultrasound, dexamethasone/TGF-beta1 and/or BMP-2 on the transcriptional expression of genes in human mesenchymal stem cells: chondrogenic vs. osteogenic differentiation. Ultra-sound Med Biol 2010;36:1022-1033.
    Pubmed CrossRef
  27. Han JJ, Yang HJ, Hwang SJ. Enhanced bone regeneration by bone morphogenetic protein-2 after pretreatment with low-intensity pulsed ultrasound in distraction osteogenesis. Tissue Eng Regen Med 2022;19:871-886.
    Pubmed KoreaMed CrossRef
  28. Wijdicks CA, Virdi AS, Sena K, Sumner DR, Leven RM. Ultrasound enhances recombinant human BMP-2 induced ectopic bone formation in a rat model. Ultrasound Med Biol 2009;35:1629-1637.
    Pubmed CrossRef
  29. Angle SR, Sena K, Sumner DR, Virkus WW, Virdi AS. Combined use of low-intensity pulsed ultrasound and rhBMP-2 to enhance bone formation in a rat model of critical size defect. J Orthop Trauma 2014;28:605-611.
    Pubmed KoreaMed CrossRef
  30. Miyazono K, Kamiya Y, Morikawa M. Bone morphogenetic protein receptors and signal transduction. J Biochem 2010;147:35-51.
    Pubmed CrossRef
  31. Scharpfenecker M, van Dinther M, Liu Z, van Bezooijen RL, Zhao Q, Pukac L, Löwik CW, ten Dijke P. BMP-9 signals via ALK1 and inhibits bFGF-induced endothelial cell proliferation and VEGF-stimulated angiogenesis. J Cell Sci 2007;120(Pt 6):964-972.
    Pubmed CrossRef
  32. Luo J, Tang M, Huang J, He BC, Gao JL, Chen L, Zuo GW, Zhang W, Luo Q, Shi Q, Zhang BQ, Bi Y, Luo X, Jiang W, Su Y, Shen J, Kim SH, Huang E, Gao Y, Zhou JZ, Yang K, Luu HH, Pan X, Haydon RC, Deng ZL, He TC. TGFbeta/BMP type I receptors ALK1 and ALK2 are essential for BMP9-induced osteogenic signaling in mesenchymal stem cells. J Biol Chem 2010;285:29588-29598.
    Pubmed KoreaMed CrossRef
  33. Suzuki A, Takayama T, Suzuki N, Kojima T, Ota N, Asano S, Ito K. Daily low-intensity pulsed ultrasound stimulates production of bone morphogenetic protein in ROS 17/2.8 cells. J Oral Sci 2009;51:29-36.
    Pubmed CrossRef
  34. Jee WS, Ma YF. The in vivo anabolic actions of prostaglandins in bone. Bone 1997;21:297-304.
    Pubmed CrossRef
  35. Harrison A, Lin S, Pounder N, Mikuni-Takagaki Y. Mode & mechanism of low intensity pulsed ultrasound (LIPUS) in fracture repair. Ultrasonics 2016;70:45-52.
    Pubmed CrossRef
  36. Saini V, Yadav S, McCormick S. Low-intensity pulsed ultrasound modulates shear stress induced PGHS-2 expre-ssion and PGE2 synthesis in MLO-Y4 osteocyte-like cells. Ann Biomed Eng 2011;39:378-393.
    Pubmed CrossRef
  37. Takiguchi T, Kobayashi M, Nagashima C, Yamaguchi A, Nishihara T, Hasegawa K. Effect of prostaglandin E2 on recombinant human bone morphogenetic protein-2-stimulated osteoblastic differentiation in human periodontal ligament cells. J Periodontal Res 1999;34:431-436.
    Pubmed CrossRef
  38. Kikuta S, Tanaka N, Kazama T, Kazama M, Kano K, Ryu J, Tokuhashi Y, Matsumoto T. Osteogenic effects of dedifferentiated fat cell transplantation in rabbit models of bone defect and ovariectomy-induced osteoporosis. Tissue Eng Part A 2013;19:1792-1802.
    Pubmed KoreaMed CrossRef
  39. Tateno A, Asano M, Akita D, Toriumi T, Tsurumachi-Iwasaki N, Kazama T, Arai Y, Matsumoto T, Kano K, Honda M. Transplantation of dedifferentiated fat cells combined with a biodegradable type I collagen-recombinant peptide scaffold for critical-size bone defects in rats. J Oral Sci 2019;61:534-538.
    Pubmed CrossRef
  40. Shirakata Y, Nakamura T, Shinohara Y, Taniyama K, Sakoda K, Yoshimoto T, Noguchi K. An exploratory study on the efficacy of rat dedifferentiated fat cells (rDFATs) with a poly lactic-co-glycolic acid/hydroxylapatite (PLGA/HA) composite for bone formation in a rat calvarial defect model. J Mater Sci Mater Med 2014;25:899-908.
    Pubmed CrossRef

November 2024, 17 (4)
Full Text(PDF) Free
Supplementary File

Social Network Service

Services

Cited By Articles
CrossRef (0)